The Dysfunctional Family Essay

In a family with one rebellious child, the other children have to â€Å"walk on egg shells† to avoid the wrath of their parents. Going beyond mere disagreement, an intense schism between family members regarding religion or ideology Lack of empathy, understanding, and sensitivity towards certain family members, while expressing extreme empathy towards one or more members (or even pets) who have real or perceived â€Å"special needs†. In other words, one family member continuously receives far more than he or she deserves, while another is marginalized Extremes in conflict (either too much fighting or insufficient peaceful arguing between family members Unequal or unfair treatment of one or more family members due to their birth order, gender, age, family role (mother, etc.), abilities, race, caste, etc. (may include frequent appeasement of one member at the expense of others, or an uneven enforcement of rules Denial (refusal to acknowledge abusive behavior, possibly bel ieving that the situation is normal or even beneficial; also known as the â€Å"elephant in the room.†) Unhealthy parenting signs: Giving â€Å"mixed messages† by having a dual system of values (i.e. one set for the outside world, another when in private, or teaching divergent values to each child) Stifled speech (children not allowed to dissent or question authority) Denial of an â€Å"inner life† (children are not allowed to develop their own value systems) Being under- or over-protective Apathy â€Å"I don’t care!† Belittling â€Å"You can’t do anything right!† Unrealistic expectations Ridicule Bitterness (regardless of what is said, using a bitter tone of voice) The â€Å"know-it-all† (has no need to obtain child’s side of the story when accusing, or listen to child’s opinions on matters which greatly impact them) Either being a miser (â€Å"scrooge†) in totality or selectively allowing children’s needs to go unmet (e.g. father will not buy a bicycle for his son because he wants to save money for retirement or â€Å"something important†) Dysfunctional parenting styles: Perfectionist (fixating on order, prestige, power, and/or perfect appearances, while preventing their child from failing at anything) Dogmatic or cult-like (harsh and inflexible discipline, with children not allowed, within reason, to dissent, question authority, or develop their own value system) â€Å"The politician† (a parent who repeatedly makes or agrees to children’s promises while having little to no intention of keeping them) Dynamics: Parents vs. kids (generation gap or culture shock dysfunction) The balkanized family (named after the three-way war in the Balkans where alliances shift back and forth) Children growing up in a dysfunctional family have been known to adopt one or more of these six basic roles: The Good Child (also known as the Hero): a child who assumes the parental role. The Problem Child or Rebel (also known as the Scapegoat): the child who is blamed for most problems related to the family’s dysfunction, despite often being the only emotionally stable one in the family. The Caretaker: the one who takes responsibility for the emotional well-being of the family. The Lost Child: the inconspicuous, quiet one, whose needs are usually ignored or hidden. The Mascot: uses comedy to divert attention away from the increasingly dysfunctional family system. The Mastermind: the opportunist who capitalizes on the other family members’ faults to get whatever he or she wants. Often the object of appeasement by grown-ups. Effects on children Children of dysfunctional families, either at the time, or as they grow older, may also: Lack the ability to be playful, or childlike, and may â€Å"grow up too fast†; conversely they may grow up too slowly, or be in a mixed mode (e.g. well-behaved, but unable to care for themselves) Have moderate to severe mental health issues, including possible depression, anxiety, and suicidal thoughts Become addicted to smoking, alcohol, and/or drugs, especially if parents or friends have done the same Bully or harass others, or be an easy victim thereof (possibly taking a dual role in different  settings) Be in denial regarding the severity of the family’s situation Have mixed feelings of love–hate towards certain family members Become a sex offender, possibly including pedophilia. Have difficulty forming healthy relationships within their peer group (usually due to shyness or a personality disorder) Spend an inordinate amount of time alone watching television, playing video games, surfing the Internet, listening to music, and other activities which lack in-person social interaction Feel angry, anxious, depressed, isolated from others, or unlovable Have a speech disorder (related to emotional abuse) Distrust others or even have paranoia Become a juvenile delinquent and turn to a life of crime (with or without dropping out of school), and possibly become a gang member as well Struggle academically at school or academic performance declines unexpectedly Have low self-esteem or a poor self image with difficulty expressing emotions Rebel against parental authority, or conversely, uphold their family’s values in the face of peer pressure, or even try to take an impossible â€Å"middle ground† that pleases no one Think only of themselves to make up the difference of their childhoods (as they are still learning the balance of self-love) Have little self-discipline when parents are not around, such as compulsive spending, procrastinating too close to deadlines, etc. (unfamiliar and seemingly lax â€Å"real-world† consequences vs. familiar parental consequences) Find an (often abusive) spouse or partner at a young age, and/or run away from home Become pregnant and/or a parent of illegitimate children Be at risk of becoming poor or homeless, even if the family is already wealthy or middle-class Have auto-destructive or potentially self-damaging behaviors Join a cult to find the acceptance they never had at home, or at a minimum, have differing philosophical/religious beliefs from what they were previously taught Strive (as young adults) to live far away from particular family members or the family as a whole Perpetuate dysfunctional behaviors in other relationships (especially their own children)

Iv Therapy

Intravenous therapy or IV therapy is when a patient is given liquid substances directly into a vein. The word intravenous means â€Å"within a vein†. Therapies administered intravenously are often called specialty pharmaceuticals. IV therapy is commonly referred to as a drip because many of the ways it is administered use a drip chamber, which prevents air entering the blood stream and allows an idea of how much is flowing in to your body. Compared with other ways of administration the intravenous route is the fastest way to deliver fluids and medications throughout the body.Some medications, as well as blood transfusions and lethal injections, can only be given intravenously. The simplest form of IV therapy is given through a hypodermic needle. This kind of needle is hollow and allows for the drip to be administered directly to the vein. The needle can be directly attached to a syringe or even to tubing that may be attached to a drip of whatever medication is needed. The need le is usually put into a peripheral vein, this is any vein not in the chest or abdomen. Any easily accessible vein can be used but most commonly veins in the hand or arm are used.In infants it is common to use the veins in the scalp. Central IV lines flow through a catheter with its tip within a large vein, usually the superior vena cava, or inferior vena cava, or within the right atrium of the heart. This has several advantages over a peripheral IV. It can deliver fluids and medications that would be too irritating to peripheral veins because of their concentration or chemical composition. These include some chemotherapy drugs. Medications reach the heart immediately, and are quickly distributed to the rest of the body.However central IV’s run a higher risk of giving you an infection, causing bleeding, and possibly even causing gangrene. A common reason to be hooked up to an IV is for dehydration therapy. Those unable or unwilling to drink or who have repetitive vomiting can receive fluid replacement IV. You are hooked up to a drip and your fluids and electrolytes are replaced through the IV in your hand or arm. There are two types of fluids that are used for intravenous drips; crystalloids and colloids. Crystalloids are aqueous solutions of mineral salts or other water-soluble molecules.Colloids contain larger insoluble molecules, such as gelatin; blood itself is a colloid. The most commonly used crystalloid fluid is normal saline, a solution of sodium chloride at 0. 9% concentration, which is close to the concentration in the blood. Ringer’s lactate or Ringer's acetate is another isotonic solution often used for large-volume fluid replacement. A solution of 5% dextrose in water, sometimes called D5W, is often used instead if the patient is at risk for having low blood sugar or high sodium. The choice of fluids may also depend on the chemical properties of the medications being given.

Bismark and the Unification of Germany Essay

1. a. The reference made here to ‘our national development won in 1866’ is an allusion to the additional power Prussia gained after its â€Å"Seven Week’s War† with Austria in 1866, which changed the balance of power in the German states, making Prussia, in stead of the now-defeated Austria, the leader of the Germanic countries. b. The â€Å"heredetary Prince of Hohenzollern† is actually the prince from the Prussian royal family chosen by the Spanish to be their leader. France had complained, and sent an ambassador to the Prussian king to get his assurance that the prince would forever renounce the Spanish throne. The king refused, and wrote a telegram to Bismarck telling him of this. This telegram (though modified here) is the one published in Germany by Bismarck in order to gain public support for a war on France. 2. The source of the telegram had been Ems, where the Prussian King was taking a leave of absence. The king sent this telegram to Bismarck to inform him of the turn of events pertaining to the French ambassador. The ambassador had wanted the king to agree that he would bind himself â€Å"for all future time never again to give his consent if the Hohenzollerns should renew their candidature†1, meaning that the king would agree to never again let any person from the Prussian royal family take power in Spain. 3. Prussia was â€Å"compelled† to go to war with France in the sense that Prussian nationalists and the public demanded it, as an upholding of Prussian honor. If Prussia did not go to war with France, it would seem as if it was afraid of her and her (Prussia’s) respect among other countries, and her own people, would be diminished. What Bismarck fundamentally means is that Prussia had to uphold her honor in the face of French insults. 4. Doc. B, that is to say the excerpt from Bismarck’s memoirs, shows us that Bismarck is above all skilled at justifying himself: he very well tells us that Prussia was â€Å"compelled† to go to war France, whereas any logical deduction would dictate it was not so. However, he also shows himself to be a master politician, taking into account among other things public opinion, and being able to both manipulate it and recognize its importance. We also are shown that he is not at all shy about using deception and propaganda to achieve his aims: it was the omissions from the Ems telegram, when it was sent to be published, which made a public furor and gave Bismarck, and Napoleon III, the public backing for war. Of his aims, more is clear: it is apparent, especially if one knows the context in which this event takes place, that Bismarck wants to expand Prussian control and power, by reducing those of others. He had already done this with Austria, and now again he wanted to prove Prussia’s power against France. 5. a. This comic, or caricature as it might be called, is a very interesting doorway to comprehending Bismarck’s philosophy. In it, he is pictured in the process of breaking eggs, and saying to the kitchen maid (who could be taken to be the King of Prussia) â€Å"you can’t make omelets without breaking eggs†. This can be taken to mean that Bismarck is saying that in order to make something good (or better), one has to unavoidably destroy other things. Taken like this, it would seem that he is saying that in order to make Prussia greater, one inevitably ruffles some feathers. b. The usefulness of these documents is severely limited: the first is a caricature, a drawing, so maybe the artist compressed the message he wanted to give, so that it would go with the image, thereby destroying some of its authenticity. However, this ‘compression’ thereby allows a very large amount of information to be presented in a format comprehensible by a very large body of people (drawings). The second document (B) is somewhat different: it is an excerpt from Bismarck’s memoirs. The problem with this format is that Bismarck perchance was not totally forthcoming in these writings, knowing they would become public. Also, written by Bismarck, they would tend to show only one (the Prussian) side of the story. However, the memoir gives us also a rare insight into the thoughts of one of history’s greatest men. Sources As a general guide for context, the following source(s) were used: * Microsoft(r) Encarta(r) Online Encyclopedia Deluxe 2001 – Article(s): â€Å"Bismarck, Prince Otto Eduard Leopold von† (c)Microsoft Corp. 1997-2000 (c) All rights reserved 1 From Reflections and Reminiscences, Otto von Bismarck. This is a quote from the telegram as it was published, in its modified form, in Germany.

Gene Analysis Essay Example | Topics and Well Written Essays - 1000 words

Gene Analysis - Essay Example Gene therapy, integrating vectors carrying therapeutic transgene sequences offers the potential for a permanent cure of genetic diseases by stable vector insertion into the patients chromosomes (1). However there are some reports indicating occurrence of tumors at later stage in transgenic animal and that's why it is important to know probability of non specific integration of this transgene and its effect on cellular homeostasis. As per the present understanding the integration is semi-random in nature and having partial preference towards sequences in or near the coding regions of expressed genes (1). Integration in these places may lead to up or down regulation of that particular gene and hence increase the probability of interference in cellular homeostasis. Based on above observations, it is highly recommended to verify the insertion loci of given vectors in model system. Based on bio-informatical analysis of given sequence, we were able to demonstrated that Viral vector integra tes in vicinity to gene called Nfib (Nuclear factor I/B) and interferes with it normal functioning. Detailed investigation and database search indicates Nfib has potential role in cell cycle regulation and oncogenesis. Vectors, transfection, cloning, amplification and sequencing were performed as per previously mention protocol (1). For identification of gene and its functionality sequence was BLAST against the Mouse genome database (http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgitaxid=10090). Similarly for further verification, sequence was BLAT (http://genome.brc.mcw.edu/cgi-bin/hgBlat) and also compared in RTCGD (http://rtcgd.abcc.ncifcrf.gov/). , to investigate presence of similar gene entry in the data base. GeneSequence: 5'AAAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAATAATAAA AGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 3' Results and discussion: The sequence was used for similarity search by BLAST in mouse genome database. All the default parameters were kept without changing for identification of match. Fig 1 shows results obtained after BLAST of given sequence. FIG 1: BLAST results >ref|NT_039260.7|Mm4_39300_37 Mus musculus chromosome 4 genomic contig, strain C57BL/6J Length=28591323 Features in this part of subject sequence: nuclear factor I/B Score = 191 bits (103), Expect = 1e-46 Identities = 103/103 (100%), Gaps = 0/103 (0%) Strand=Plus/Plus Query 2 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 61 Sbjct 21590158 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 21590217 Query 62 AATAAAAGACAGCCAGTTGAAGGAAGAtttttttttttCAATT 104 Sbjct 21590218 AATAAAAGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 21590260 As seen above, 100% matching were obtained with very low E values (1e-46) which clearly indicates the given sequence belongs to gene called nfib (Nuclear factor I/B). It is located on chromosome 4 (Chr4:81761404-82176981 bp, - strand). Nfib is member of protein family having diverged role in transcription and cell cycle regulation.Similarly BLAT analysis retrieves same gene against the query of given sequence.

Apocalypse Essay Example | Topics and Well Written Essays - 500 words

Apocalypse - Essay Example The film has its direction of Edgar Wright. The story is about a man who is attempting to get focus on his life and deal with a bigger issue of dealing with the rising of the Zombie Apocalypse. The film depicts the current cultural phenomenon in Hollywood and around the world as we will see when comparing and contrasting the two films. The antagonists in both the "Blade Runner" and "Shaun of the Dead" depict human-like characteristic in their physical form but are still monsters. The stories are science fiction that depicts the robot apocalypse and a zombie apocalypse. They are both set in the future. The changes that modernity brought into the world and advancement in technology is what led to the making of the two films. "Shaun of the Dead" shows anxiety through the spread of viral capitalism around the world. The zombie apocalypse leads to denial of the people to ever go back to normalcy (Wright, 2004). "Blade Runner" also has a form of denial when the cooperations that comes up with replicants who do not want to go back to humans. It is because the replicants are more human than human beings (Scott, 1982). It shows how the future people are satisfied with the apocalypse of either zombies or genetically engineered replicants. There is a fear among the human race about a possible apocalypse as we see the making of the two films. The human beings in both films defend themselves from the unwanted creatures that have invaded the earth. â€Å"Shaun from the dead† has the people from the bar defend themselves after the return of the zombies to haunt them. The zombies feed on human beings thus the rise of the zombies means the end of the human population (Wright, 2004). The replicants from â€Å"Blade Runner† are also created to finish the human population as they are superior to human beings. The humans must, therefore, fight against the robots before the monsters lead to their end. We see the fight between human beings and the replicants from the film (Scott,

Describe and analyse the supply chain for gold, this could either be Essay

Describe and analyse the supply chain for gold, this could either be in the form of a product or discussed in terms of a commodity - Essay Example (Graham, 2005) Gold as a commodity goes through different stages of transformation and as such is an important part of the luxury products being used by the consumers all over the world. The traditional suppliers of gold are scattered through different parts of the world however, it is also important to understand that gold suppliers have traditionally being located in conflict areas where significant political and ethical issues have been raised. Due to these differences in the extraction and refining of gold, the overall supply chain becomes relatively complex due to involvement of different players at different stages. Further, since gold is supplied in different forms therefore the overall supply chain of the gold is not linear in nature but is rather cyclical in nature. Further, since it can be owned and supplied by different suppliers in the market therefore its supply chain is relatively non-linear in nature thus making it more complex as a process. (Pereseina, Jensen and Hertz, 2013) Due to the very nature of the gold, it is supplied either through mining or through the scrap however; major source of supply is that of the mining. The mining supply source is major source of supply whereas scrap supply is minor supply source in the industry. The second phase in the gold mining supply chain is that of the refining as it comes after the extraction of the gold from soil. It is critical to note that refining process can also takes place at the site as well as that of the refineries. In this case, the gold in raw/extracted form in transported to the refineries for this purpose. Further process in gold comprises of further processing, refining and finally its making and development of gold product. One of the key issues in the traditional supply chain of gold is that of ascertaining the ethical origin of the gold extracted. Since gold is often extracted from

Should the UK withdraw from the European Convention on human rights Essay

Should the UK withdraw from the European Convention on human rights - Essay Example Sovereignty of the parliament dictates that the parliament has the sole discretion to make and amend laws in the UK. No person or body is recognized by the UK legislation to overrule the law made by the parliament. In this spirit the parliament is seen to be competent to make any laws. Laws that deprive the citizens of their right to property, liberty, voting, and life among others should be seen as valid so long as they have been passed by the parliament. This is done in faith that the parliament can exercise self restraint and only pass laws that are at par with the moral standards. However, this has not been the case always because some politicians have normally put their own selfish interests at the cost of national interests. The ECHR being an international body helps to regulate such offensive or repugnant laws. The citizens of Britain should advocate against their government withdrawal from the convention. This is for the benefit of regulation of the laws that the parliament may pass. The Human Rights Act of 1998 and its Problems The human rights act of 1998 was drafted on the principle of protection of human rights but reconciled with the sovereignty of the state (UK Government, 2012). Under this act, the parliament may make legislations and the courts may not necessarily quash them on the grounds of inconsistency with the European Convention on human rights. In fact, it is only the higher courts that should interpret the legislations and determine their inconsistency. The higher courts may only declare incompatibility where it is very clear. This act was put forward in order to ensure parliamentary sovereignty. ... an Rights Act of 1998 and its Problems The human rights act of 1998 was drafted on the principle of protection of human rights but reconciled with the sovereignty of the state (UK Government, 2012). Under this act, the parliament may make legislations and the courts may not necessarily quash them on the grounds of inconsistency with the European Convention on human rights. In fact, it is only the higher courts that should interpret the legislations and determine their inconsistency. The higher courts may only declare incompatibility where it is very clear. This act was put forward in order to ensure parliamentary sovereignty. However, the enactment of the act has transformed the constitutional environment in which the parliament’s legislative power exists; the legislative powers have been altered. Three features of the act pose problems to its enactment and goes against the ECHR. The first problem is that the act places the power to interpret whether the acts are consistent wi th convention rights in the hands of the judiciary. This greatly alters the process of interpretation of the legislation. This has two implications; it is rare for legislation properly interpreted to go against the human rights norms. The parliament will always use a clearer and precise language if it wishes to abrogate human rights. The use of clear language draws the attention of public and the parliament. The government may put a strong justification of the legislation to win the public support. This legislation may be infringing on the rights of the people but it may escape the eyes of the judiciary which has been given the ultimate power to determine its compatibility with the rights convention (Elliot, 2002). The second problem is that the minister in-charge of the bill should make a

Climate Change and the Experience of Poverty Essay

Climate Change and the Experience of Poverty - Essay Example Mitigation encompasses reducing the impact that one has on the environment through reduction of one’s carbon footprint among other activities. Conversely, adaptation involves dealing with consequences of climate change by say, establishing methods of coping with regular floods. A gap exists in current literature on the relationship between climate change and poverty. Several analysts tend to focus on mitigation at the community level. Institutions have been formed to minimise energy use through transport. Others have addressed housing and urban development (Berrang-Ford et. al., 2011). While these efforts may contribute to long term solutions for the country in general, they do not address the direct challenges that disadvantaged community members face when dealing with extreme weather events. ... It is imperative for stakeholders at the national, corporate and local levels to target this group when creating interventions. Extreme weather events (Such as floods, storms, and cyclones) are a manifestation of climate change and have adverse effects on disadvantaged communities. Poor people live in less-robust settlements that often leave them defenceless against these situations. Furthermore, they lack information of how to protect themselves during such events. Demetriades and Esplen (2008) note that actions are necessary in order to strengthen the resilience of the vulnerable during extreme weather events. Stakeholders may empower the disadvantaged through information dissemination, infrastructural preparedness, housing tenure agreements, among others (McCright, 2010. One of the ways in which these changes are manifested is through community projects. Nongovernmental organizations and special interest groups may carry out community projects to build resilience among disadvantag ed communities. It is imperative to understand why such groups are performing this role, and whether their activities arose from gaps in policy interventions from the national and local governments. Community projects are insufficient as a coping strategy for disadvantaged communities (Zsamboky et. al., 2011). However, they represent an attempt by non-state actors to participate in an issue of grave national consequences. Their presence in deprived areas indicates that policy-makers may not be doing enough to prepare these communities for extreme weather conditions. Runhaar et. al. (2012) carried out a study in the Netherlands to assess the stimuli and barriers to climate change adaptations in urban areas. They found that a gap

Search Language and Search Engines Essay Example | Topics and Well Written Essays - 500 words

Search Language and Search Engines - Essay Example The numbers and letters can lead to other similar books and locations throughout the library. Search engines are also very helpful as they are a replacement of the classic style of searching. Before search engines, research could be conducted by standard index cards. The researcher would have to look through the index cards and read the catalogues to understand and be able to locate the title. Now, search engines allow the researcher to type in a few key words. These key words enable the researcher to browse through a list of titles that pertain to the researcher’s topic. One can decide to do a basic or a guided search. These two different forms of research will assist me in my search of possible sources regarding welfare reform. Using the internet to search through publications can be challenging and lead to irrelevant and false sources. The library of congress only contains credible sources and using the guided search can help narrow down specific categories of welfare reform. For example, accessing the library of congress website and choosing to perform a guided search will bring up substantial amounts of information. The guided search will bring up topics that are newer in publication and provide more current information. To the right of the search engine screen there is a date. Choosing titles with the most current date will assist in locating current

Supercool advising the partnership on their chances of successfully Essay

Supercool advising the partnership on their chances of successfully defending claims from John in connection with the bar furniture - Essay Example Under the terms of the contract Supercool would provide a large glass show case for six months, which would be both stocked and maintained by employees of Supercool in Inky’s bar located at the football ground. The contract also contained a clause that Supercool would not be liable for any loss or damage caused during stocking or maintenance of the show case by the staff of Supercool. John is now demanding compensation for damage caused to the bar area, and Supercool have referred John to the clause in the contract. Whenever there is a disagreement or dispute between members of a society, or between organisations the matter would have to be resolved by applying the law, through the courts. There are different types of laws such as the constitution law and the common law. In many cases judges will use previous cases to help solve a current case. This process is called precedents, which means to follow the decision of other judges in similar cases to solve their case.

Development Plan Reflection Essay Example for Free

Development Plan Reflection Essay Whilst reading various sources on the importance of reflecting after an experience I came across some wise words, that of Aitchison and Graham cited in Stoobants et al (2007:30) that say, â€Å"We do not learn from experience. Experience has to be arrested, examined, analysed, considered and negotiated in order to shift it to knowledge†. With these words in mind I began to see why it is important to reflect on my first MBA assignment. I see the MBA course as a learning journey, it is through reflecting on my past experiences that I will easily identify my strengths and weaknesses and thus easily identify areas that I should concentrate on developing during my MBA journey. In this assignment you will read about an experience that happened during the early stages of my career as a manager. I will analyse and discuss how this experience has led to where I am today and how it has affected my plans going forward in both my personal and working life. This was in year 2010. I was asked to act in the role of Management Accountant as my manager at that time resigned. I was then already hungry for more challenges and so I gladly accepted without hesitation as I was determined to prove that I am ready for it. Later that day it suddenly dawned on me that it was going to be challenging with the many vacancies in the team (Refer to Appendix 1 for the team structure). With this challenge in mind, I rearranged the team in order for it to work better. We embarked n the annual budget process later that year which did not go well as we did not complete the budget presentation within the stipulated timelines, did not get to analyse the critic all the numbers thoroughly and as a result the region was not ready for presenting the annual budget on time to Head Office. Post the experience below are the key things that I took out of that experience that I thought would enable me to manage teams better going forward: * Ensure that adequate training on the system is provided and requesting the business to provide more IT support people even outside of business hours during the budget process. Learn to lead and delegate and know that I cannot juggle my role and others as I can only achieve so such myself as I was doing most of the work that needed to be done by the Financial Planner: Benrose. * Seek advice from manager and not be afraid to ask for coaching. * Plan better around the timelines to take into account inexperience of some of my team members e. g. Plan a trial run presentation * Be more assertive as I realised that as a manager I could have negotiating additional resources since our headcount was lean so as not to compromise our deliverables. After having been through my first workshop at Henley, I liked Belbin (1981)’s team role model that was presented and in his book where he goes on to look at why management teams succeed or fail which I ironically discovered lying in my parents study and till now never bothered to even look at. He identifies 9 team roles in 3 categories. The action orientated people (Shapers, Implementers and Complete finishers). The thought orientated people (Co-ordinators, Teamworkers and Resource investigators). The last group are the people orientated (Specialists, Monitor evaluators (MEs) and plants). Had I applied his model to understand my team dynamics prior to starting the budget process, I would have seen that I had gaps in key roles that prevented us from completing the task on time. Please note the below roles assigned to my team members are just based on my own perception based on how I know them not based on the questionnaire that is normally completed. AFP – Implementer and Resource Investigator (She was the organiser for the team and was good at providing new knowledge or something new discovered whilst working on the new system and she would share it with the rest of the team) * FP Midrand – Plant and Resource Investigator (He was creative and generally looked at issues, he was cheerful and enthusiastic individual but was easily distracted and would want to start looking at new things without completing a task) * Me – Specialist and Monitor Evaluator. These were my top 2 roles from the results of the questionnaire I completed for my first workshop at Henley. I was a specialist in the team because I had more knowledge of the business and finance than my team. In retrospect, I would have been able to easily match the correct people with the rights tasks. I also could have put plans in place to ensure the following: * I had no shaper in the team. Belbin describes a shaper as generally someone able to drive a team and give direction – not having this I think contributed to us missing the deadline. So in requesting additional resources (e. . a temp person the business would have allowed) I could have ensured that I selected someone who is a shaper or developed more of shaper qualities in myself. * As we did not get to critically analyse the numbers prior our submission, if we had someone strong on being a completer finisher in the group chances of us submitting quality information would have been high as this role is effectively used at the end of a task, to â€Å"polish† and scrutinise the work for errors. I would definitely use this to my advantage going forward in my team tasks going forward.

Action Research in the Classroom Essay Example for Free

Action Research in the Classroom Essay The classroom is a very interesting place to start. As a teacher, there are a lot of privileges for me since the students look up to me as an authority figure. Admittedly, there are times that dealing with students can become very stressful, especially in moments that students are very difficult to direct and control. When kids become naughty and the teacher does not have the sensitivity and the patience to deal with them, it might simply become a nightmare. Even if the teacher has a natural penchant for loving and teaching kids, it can still be a bit of challenge to teach them. Â  The teacher has a very important role in the intellectual and social development of the kids in the school. If they do not appreciate education, it is the duty of the teacher to inculcate in them the importance of education for themselves and for their future. This cannot be done, however, by shoving these ideas down their throats. Rather, what is needed is a careful observation of their ways, the things they enjoy as well as the different modes of learning that they have, the activities they enjoy inside and outside the school. By undertaking an action research and carefully observing the students, the teacher will be able to understand the students more and use this understanding in making the classroom more effective in terms of educating the students and preparing them for the future ahead of them. Some of the areas of observation would be the study habits of the students, their social standing in the community and how this impacts their studies, the social activities they enjoy inside and outside the school, the role of their parents, their learning styles, and the different media that they are exposed to. The observations presented in this action research may be a bit crude, yet they may be expanded upon as time passes by and a better understanding of the students will be arrived at. Study Habits Action research demands keen observation skills regarding the different areas identified by the researcher (Avison, Lau, Myers Nielsen, 1999). In observing the study habits of the students, what I have looked for is the way that they regard the library, the media that they enjoy well and the different kinds of media that they are exposed to. In going through these observations, I looked at the rate of submission of homework by the students; I also went to the library and conducted random observations if my students were there. In terms of preparation of homework, a number of students were not very keen in completing their homework. A handful of them heeded my requests for them to study and complete some homework. Both honor students and some silent kids showed aptitude in completing homework. Those who did not complete homework tended to be those who are very playful and did not show great concern for their studies. My trips to the library were not very fruitful. The number of students who frequently visit the library does not even exceed the number of my fingers in one hand. Only when I gave an assignment that expressly required them to go to the library did they go there and looked for the information I requested them to look up. Perhaps this may be explained by the proliferation and the widespread use of the Internet among my students. Most information can be found in the Internet, so they may choose not to go to the physical library anymore and simply type some words and click on some links. The challenge is therefore to make students realize the value of the library. Economic and Social Standing My students are predominantly white although there are Asians, Hispanics and Blacks interspersed. Most of them were either in lower middle class and those who are found in the middle of the middle class segment of the society. As such, most of the kids did not enjoy great amenities and economic riches. Those who belong to the upper middle class tend to have parents who exert greater influence on other teachers and on the school in general. Because of their social standings, more than half of my students had to keep part-time jobs to pay for their bills and meet some of their needs. This also poses another challenge for the teacher. Even if they did not absent themselves from school frequently, because of their work, there were times that their study habits were affected. Instead of spending their time in reading their lessons, they have to work and earn money. This may also explain why a lot of them were not able to do their homework. Once when I was in the mall, I encountered a student of mine working there and had a conversation with her. After that, I decided to also look at the work of my students and look at the nature of their work and how the nature of their jobs affects their studies. Truly, economic situations affect the well-being of the students. But since they have no choice, then the teacher would have to do his best to take into account these realities in the way that they are being taught. Activities Outside the School Students who belong to higher economic status tend to enjoy more time outside the school. They hang out at some cafes or snack bars where they can chat about school. I also asked several of them regarding the activities that they do and these kids also tend to sleepover at each other’s homes. Students who belong to lower income families, however, tend to limit their outside school activities so that they can earn some money for personal and for family use. They still hang out with some of their friends; however, this is less frequent than the students from higher income families. Another activity that occupies the leisure time of students is their use of game consoles such as Playstation and Xbox. Through these bonding moments, they develop their relationships with their friends. This is also their way of relaxation. Connecting to the Internet and connecting socially to friends. Video games is also a past time that some students told me they do during their leisure time. The Role of Parents I was not able to observe directly the role of the parents in the education of the students. From my conversations with students, however, those who belong to middle class and higher income families usually have their parents reminding them to study well and do their best. This in turn encourages the students to study better. In some cases, parents promise rewards for their children if they perform up to a certain level. Those from lower income families, however, do not have very encouraging parents. Rather, they are expected to help out in paying some of the bills in the house. This arrangement, however, does not seem to dampen the desire of some students to study well. There are those, however, who tend to get discouraged with this and focus more on their jobs than on their studies. Implications for the Teacher The teacher has a very important role in the development of the students; especially so, because he gets to stay with the kids longer than their parents. Observing students and trying to know them more deeply will help the teacher in dealing with the students. With the sheer number of students, however, it is difficult to observe each and every student. Nonetheless, the teacher is called upon to establish meaningful relationship with students because then, the process of teaching becomes more enjoyable. The teacher has to vary his teaching style depending on the students and their backgrounds. Their study habits has to be understood well so that the teacher will know how to approach them and present the lessons in such a way that the students will understand. Not only that, when their learning style corresponds with the teaching style of the teacher, then they will not only learn but they will also come to love the way that the teacher teaches. Conclusion Action research enables the teacher to become a part of the world of the students instead of simply a detached outside force in the classroom. When this is undertaken, it opens up important insights, which can help the teacher improve his teaching strategies and style. The teacher’s role in the life of the students is very important. As such, it should not be taken lightly. By becoming immersed in the life and the studies of the students, the teacher becomes a friend and a mentor to his students. Reference Avison, D., Lau, F., Myers, M. Nielsen, P. A. (1999). Action Research. Communication of the

Dispersion Properties of the Propagation of Linear Waves

Dispersion Properties of the Propagation of Linear Waves ABSTRACT In electron-positron plasmas some of the plasma modes are decoupled due to the equal charge to mass ratio of both species. The dispersion properties of the propagation of linear waves in degenerate electron–positron magnetoplasma are investigated. By using the quantum hydrodynamic equations with magnetic fields of the Wigner–Maxwell system, we have obtained a set of new dispersion relations in which ions’ motions are not considered. The general dielectric tensor is derived using the electron and positron densities and its momentum response to the quantum effects due to Bohm potential and the statistical effect of Femi temperature. It has been demonstrated the importance of magnetic field and its role with the quantum effects in these plasmas which support the propagation of electromagnetic linear waves. Besides, the dispersion relations in case of parallel and perpendicular modes are investigated for different positron-electron density ratios. Keywords: Quantum Plasma; Dispersion relation ; Electron –Positron 1- INTRODUCTION Electron-positron (e-p) plasmas are found in the early universe, in astrophysical objects (e.g., pulsars, super nova remnants, and active galactic nuclei, in ÃŽ ³ -ray bursts, and at the center of the Milky Way galaxy [1]. In such physical systems, the e-p pairs can be created by collisions between particles that are accelerated by electromagnetic and electrostatic waves and/or by gravitational forces. Intense laser-plasma interaction experiments have reported the production of MeV electrons and conclusive evidence of positron production via electron collisions. Positrons have also been created in post disruption plasmas in large tokamaks through collisions between MeV electrons and thermal particles. The progress in the production of positron plasmas of the past two decades makes it possible to consider laboratory experiments on e-p plasmas [2]. The earlier theoretical studies on linear waves in electron–positron plasmas have largely focused on the relativistic regime relevant to astrophysical contexts [3]. This is largely due to the fact that the production of these electron–positron pairs requires high-energy processes. In laboratory plasmas non-relativistic electron–positron plasmas can be created by using two different schemes. In one scheme, a relativistic electron beam when impinges on high Z-target produces positrons in abundance. The relativistic pair of electrons and positrons is then trapped in a magnetic mirror and cools down rapidly by radiation, thus producing non-relativistic pair plasmas. In another scheme positrons can be accumulated from a radioactive source. Such non-relativistic electron–positron plasmas have been produced in the laboratory by many researchers. This has given an impetus to many theoretical works on non-relativistic electron–positron plasmas. Stewart and Laing [4] studied the dispersion properties of linear waves in equal-mass plasmas and found that due to the special symmetry of such plasmas, well known phenomena such as Faraday rotation and whistler wave modes disappear. Iwamoto [5] studied the collective modes in non-relativistic electron–positron plasmas using the kinetic approach. He found that the dispersion relations for longitudinal modes in electron–positron plasma for both unmagnetized and magnetized electron–positron plasmas were similar to the modes in one-component electron or electron–ion plasmas. The transverse modes for the unmagnetized case were also found to be similar. However, the transverse modes in the presence of a magnetic field were found to be different from those in electron–ion plasmas. Studies of wave propagation in electron–positron plasmas contin ue to highlight the role played by the equal mass of electrons and positrons. For example, the low frequency ion acoustic wave, a feature of electron–ion plasmas due to significantly different masses of electrons and ions, has no counterpart in electron–positron plasma. Shukla et al [6] derived a new dispersion relation for low-frequency electrostatic waves in strongly magnetized non-uniform electron–positron plasma. They showed that the dispersion relation admits a new purely growing instability in the presence of equilibrium density and magnetic field inhomogeneties. Linear electrostatic waves in a magnetized four-component, two-temperature electron–positron plasma are investigated by Lazarus et al in Ref. [7]. They have derived a linear dispersion relation for electrostatic waves for the model and analyzed for different wave modes. Dispersion characteristics of these modes at different propagation angles are studied numerically. In this work, The dispersion properties of the propagation of linear waves in degenerate electron–positron magnetoplasma are investigated. By using the quantum hydrodynamic equations with magnetic fields of the Wigner–Maxwell system, we have obtained a set of new dispersion relations in which ions’ motions are not considered. The general dielectric tensor is derived using the electron and positron densities and its momentum response to the quantum effects due to Bohm potential and the statistical effect of Femi temperature. 2- MODELING EQUATIONS We consider quantum plasma composed of electrons and positrons whose background stationary ions. The plasma is immersed in an external magnetic field . The quasi-neutrality condition reads as . From model, the dynamics of these particles are governed by the following continuity equation and the momentum equation: (1) (2) Here and are the number density, the velocity and the mass of particle respectively () and is the plank constant divided by. Let electrons and positrons obey the following pressure law: Where, is the Fermi thermal speed, is the particle Fermi temperature, is the Boltzmann’s constant and is the equilibrium particle number density. We have included both the quantum statistical effects through Fermi temperature and the quantum diffraction in the –dependent. If we set equal to zero and equal the temperature of electrons and positrons, we obtain the classical hydrodynamic equation. Assuming that the plasma is isothermal, the Fermi speeds for different particles may be equal. Using the perturbation technique, assume the quantity representing (n, u, B, E) has the following form where is the unperturbed value and is a small perturbation . Assuming the equilibrium electric field is zero and linearizing the continuity and the momentum equations, we have: (3) (4) Multiplying equation (4) by and Simplifying, we can obtain the following equation: (5) where, , , and Assuming, , then the three components of the fluid velocity can be written as: (6a) (6b) (6c) Where, and The current density and the dielectric permeability of the medium are given: (7) (8) where is the unit tensor. So, we can obtain the dielectric tensor as follows: (9) Where, Then, according to equations (8), (9) The propagation of different electromagnetic linear waves in quantum plasma can be obtained from the following general dispersion relation: (10) Where, is the plasma frequency and . 3- DISCUSSION In this section, we focus our attention on the discussion of some different modes in two cases that the wave vector parallel and perpendicular to the magnetic field . (3.I) Parallel modes So, this case leads to, with . Therefore the general dispersion relation (10) becomes: (11) This gives two dispersion relations. The first one () investigates the dispersion of electrostatic quantum waves included the quantum effects as follows (12) By neglecting the quantum effects, equation (11) describes the following well-known classical modes The second dispersion equation gives: (13) Equation (13) is similar to the dispersion of left and right waves (L- and R- modes). Owing to the symmetry between the positively and negatively charged particles, the dispersion relation for the right circularly polarized wave is identical to the left circularly polarized wave. It has been noted that no quantum effects on these modes. For unmagnetized plasma , the dispersion relation becomes: (14) (3.II) Perpendicular mode In this case, we have So, the general dispersion relation (10) becomes: (15) Where it has the following new elements , , , , , , , In the case of unmagnetized plasma , we have the following two dispersion equations: (16) and (17) The equation (16) is the well known dispersion relation which investigates the propagation of electromagnetic waves in classical unmagnetized plasma.The damping is absent because the phase velocity of the wave obtained from this equation is always greater than the velocity of light, so that no particles can be resonant with the wave. This results is analogous to the one-component electron plasma [5]. While the other relation (17) indicates the dispersion of the waves in electron-positron plasma under the quantum effects. 4- NUMERICAL ANALYSIS AND RESULTS In this section, we are going to investigate the above dispersion relations numerically. Introducing the normalized quantities , , , , and the plasmonic coupling () which describes the ratio of plasmonic energy density to the electron Fermi energy density, we rewrite some of the dispersion relations in both of parallel and perpendicular modes. (4.I) Parallel modes In the first, equation (12), () becomes: (18) Where, . The dispersion relation (17) has two positive solutions, Fig 1, for positron electron density ration with and .One of solutions of the dispersion equation (19) can be investigated in Fig. (2) to study the parallel modes for different density ratios with in quantum plasma . The solution of the normalized dispersion equation (17) has been also displayed in 3D figure (3) for quantum unmagnetized plasma . It is clear from the previous figures that the dispersion relations depend strongly on the density ratio of positron to electron. As the positron density is increased to equal to the electron density, the phase velocity has been increased. In the beginning, with very small positron density the wave frequency equals the electron plasma frequency and decreased with positron density increased. Besides, in the Fig. (4), the dispersion relation of parallel modes is shown for different quantum ratios , in the case of positron-electron density ratio and equal velocities of them . It is clear that the phase velocity of the mode is increased with the increases of plasmonic coupling ratio. (4.II) Perpendicular mode In the case of perpendicular modes, equation (15) can be normalized and solved numerically (here, ). Figure (5) displays the dispersion curves of electromagnetic modes under the effect of different density ratios in classical plasma. Also, the other equation (16) can be solve numerically to give two real solutions. One of them is the same solution approximately of equation (15) (which is clear in Figure (6). The other solution of dispersion equation (16) is displayed in figure (7). It is clear in the figures that the dispersion curves at depend essentially on the positron-electron density ratio . As the positron density increases to equal electron density, the wave frequency is increased to be bigger than the plasma frequency. On the dispersion curves (figures (5) and (6)), it has been noted the phase velocity of modes (+ve slope of the curves) decreases as density ratio increases. But, on the figure (7), the phase velocities of these modes (-ve slope) are the same with changes of the density ratio. They tend to zero with large wave number which means that these modes cannot propagate in plasmas. Figure (8) investigates the dispersion relations of the electromagnetic waves in electron-positron plasma under the quantum effects. It is clear that, in the case of classical plasma, the wave frequency decreases as wave number increases (the phase velocity is negative). But, in the case of quantum plasma (for small ratio ), the wave frequency deceases as wave number increases (the phase velocity is negative). Then, the phase velocity and group velocity tends to zero at definite wave number () depends on the quantum ratio (). For high quantum ratio, the phase velocity starts to be +ve and increases again. 5-CONCLOUSION In this work, The dispersion properties of the propagation of linear waves in degenerate electron–positron magnetoplasma are investigated by using the quantum hydrodynamic equations with magnetic fields of the Wigner–Maxwell system. The general dielectric tensor is derived using the electron and positron densities and its momentum response to the quantum effects due to Bohm potential and the statistical effect of Femi temperature. We have obtained a set of new dispersion relations in two cases that the wave vector parallel or perpendicular to the magnetic field to investigate the linear propagation of different electromagnetic waves. It is clear that the quantum effects increase or decrease the phase velocity of the modes depends on the external magnetic field. Besides, it has shown that the dispersion curves at depend essentially on the positron-electron density ratio such as the positron density is increased to equal electron density, the wave frequency of the modes is increased.. Fig.(1). The dispersion relation (5.19) has two positive solutions for positron electron density ration with and Fig. (2) The dispersion relations of the modes for different density positron-electron ratios with and Fig. (3). The dispersion relations of the parallel modes along density ratioaxis with and Fig.(4). The dispersion relations of different modes for different quantum effects with positron-electron density ratio and velocity ratio .. , Fig. (5.5). The dispersion relations of electromagnetic modes for different ratios in classical plasma. Fig.(6). The dispersion solutions of the equations (5.17) and (5.18) for different density ratios . Fig. (7). The other dispersion solutions of the equation (18) for different density ratios . Fig.(8). 3D plotting for dispersion relation for perpendicular modes in quantum unmagnetized plasma along quantum ratio axis with

The Travellers: Ireland’s Ethnic Minority :: Essays Papers

The Travellers: Ireland’s Ethnic Minority Who are the Travellers? The Travellers, a minority community indigenous to Ireland, have existed on the margins of Irish society for centuries. They share common descent, and have distinct cultural practices - early marriage, desire to be mobile, a tradition of self-employment, and so on. They have distinct rituals of death and cleansing, and a language they only speak among their own. Travellers are not overtly conscious of a sense of group history. Concern with ancestry is an obsession of those who value permanence of place. Rather, the individual is defined by his/her place within the relationship network. They live in extended patriarchal families, prefer trailers, tend to nomadism interspersed with occasional house dwelling, and maintain a nomadic mindset even when settled; a house is considered only a stopping place between journeys, whether the stop lasts 20 days or 20 years! There are an estimated 21,000 Travellers currently living in the Republic of Ireland, over half of whom have no access to toil et facilities, electricity, refuse collection or piped water. In the past they invariably travelled, but misguided government policy from the 1960s onward ensured that many were persuaded to settle in houses – a policy that, in undermining traditional values and lifestyle, is increasingly questioned, if not actively altered. Traditionally, they were metal workers, hawkers, traders in horses and used goods of all description, and provided services where and when there were gaps in the market. This resistance to wage labour and alternative cultural definition of work led to charges of idleness by the uncomprehending. The necessity of living on their wits led to a stereotype of Travellers as shrewd, even cunning, dealers. Having been persuaded to settle in houses, and consequently, having lost the mobility necessary to their traditional trades, many Travellers today rely on state welfare assistance. This could be construed as a sinister government plot, but for the fact that government policy on Travellers has never been well planned enough to effect any successful strategy! Ironically, Traveller representative Michael McDonagh believes that â€Å"Travellers that are the most nomadic are also the most economically successful, and also have far less difficulty with their identity than people forced into settlement† (quoted in â€Å"Nomadism in Irish Travellers’ Identity†. From Irish Travellers: Culture and Ethnicity.Eds. McCann et al. Belfast: Institute of Irish Studies, 1994, 95-109). Their position is akin to that of the gypsy of Europe in some respects.

Driving While Under the Influence of Alcohol :: Drinking and Driving, Drunk Driving, DUI

Driving While Under the Influence of Alcohol Driving a vehicle while under the influence of alcohol is one of the most dangerous things you can do. There is a mass of research evidence to show that driving performance and reaction times are seriously affected by alcohol. If you drink and drive, you are not only a danger to yourself but also to your passenger, other road users and pedestrians. In fact, every 30 minutes, someone in this country dies in alcohol-related crash. Every 30 minutes! And last year alone more than one million people are injured in alcohol-related traffic crashes. Alcohol is a depressant that slows down body reactions and the working of the brain. Each year drunk driving is responsible for about 25% of these deaths. The risks of drinking are alcohol-related accidents and violence. The effects of alcohol are poor coordination and slurred speech, double vision, decrease of self control loss of consciousness and death. There are legal consequences due to drinking also. The more a person drinks, the more their ability to make important decisions becomes impaired. After just one drink, a driver can lose their ability to perform the tasks necessary to drive a car. At a certain point, a driver will become illegally intoxicated and can be arrested for attempting to operate a motor vehicle. In every state on out country there is a legal limit to how much alcohol you can have in your body if you are driving. If you drink and drive you can lose your driver's license and even go to jail. Traffic crashes are the leading cause of death for teens and young adults. More than 5,000 young people die every year in car crashes and thousands more are injured. Drivers who are 16 years old are more than 20 times as likely to have a crash as are other drivers. There are two main reasons why teens are at a higher for being in a car crash and lack of driving experience and their tendency to take risks while driving. Teens drive faster and do not control the car as well as more experienced drivers. Their judgment in traffic is often insufficient to avoid a crash. In addition, teens do most of their driving at night, which can be even more difficult. Standard driver's education classes include 30 hours of class-room teaching and 6 hours of behind-the-wheel training. This is not enough time to fully train a new driver. Teen drivers are more like to be influence by peers and other stresses and distractions. This can lead

Post Modernism and Architecture Essay -- Architecture Post Modernism A

Post Modernism and Architecture If one were to walk around and casually ask five people what post modernism was they would probably get five different answers or none at all. It is one of those indefinable academic terms that applies to many different fields of study. Most people seem to understand what it means individually but few agree collectively. To make matters even more complicated, it is often used in discussions about deconstruction. "To some Post Modernism is an excuse to pile together oodles of wild and crazy decor, to others it is another example of the weakness of standards and values. While some think that it is trangressive resistance to the sureness of categories, to others a handy way to describe a particular house, dress, car, artist, dessert, or pet, and to others it simply over already. Clement Greenberg defined post-modernism in 1979 as the antithesis of everything that he loved. The lowering of aesthetic standards caused by the democratization of culture under industrialism. Where most people agree though is that post modernism first started with architecture in the 1950’s. It occurred as a reaction against the international Style. So that is the aspect that I am going to concentrate on in my paper. As post modern applies to architecture it means The combination of Modern techniques with something else usually traditional building. First off Some of the most famous architects that concentrate on post Modern Design are Alvar Alto, and Robert Venturi. Alto is probably the most famous out of the three that I named. Alto was born 1898 in Kuortane on February 3. He received his diploma of architecture in 1921 from the Institute of Technology which is located in Helsinki. He had private architectural office in Jyvà ¤skylà ¤ from 1923-27. He was married to a fellow architect Aino Marsio in1924. She shortly after died in 1949. From the times of 1927 through 1933 he had another private architectural office this time it was in Turku. The last private office that he had was in 1933 it was in Helsinki. From the time period1943 to 1958 he was the Chairperson of the Association of Finnish Architects and Professor at Massachusetts Institute of Technology, which is in Cambridge USA. In 1952 he remarried to another architect by the name of Elissa Mà ¤kiniemi. In 1955 he became a member of the finish academy and... ...t Modernism can hardly be talked about without deconstructionism also being mentioned. Deconstruction is when the architects think that the design of societies' buildings should resemble societies present state. For example today’s society is chaotic, so the architecture should be chaotic too. For example the buildings columns and structure are crooked and the walls tilted. Deconstruction is a kind of post modern design. They seem to directly relate to each other. Deconstruction is post modern with a twist it is never straight and it is always crooked lines the walls can be tilted and the structures all crazy like. My opinion on the whole mess is that some of the architecture can be really beautiful but others can be extremely screwy. I personally have always had an interest in architecture so this assignment, after I figured out what I was supposed to do, was fun. I am not going to become an architect though, I like animals to much and I aspire to be veterinarian. My favorite piece that I saw was the Getty Museum. Just the way that it is set and designed to look old but has all the beautiful new stone and materials. It was just the first one to catch my eye.

Cost and Quality Relationship Memo Essay

Many of the reforms contained within the Patient Protection and Affordable Care Act (PPACA) are aimed at reducing health care costs and improving quality without rationing care, cutting benefits or reducing eligibility. Starting with the populations that suffer from the most difficult health conditions and have the most medical expenses makes sense. If designed and implemented properly, these reforms hold the potential to transform not only their lives, but also to serve as models for other populations. However, this promise cannot be realized without the informed and meaningful participation of patients, families and their advocates. The problem: our fragmented system There is widespread acknowledgement that our current health care system is fragmented, failing to consistently deliver high quality care, particularly to certain vulnerable people, such as: those with multiple chronic conditions, the frail elderly, people who are dually eligible for Medicare and Medicaid, and members of a racial or ethnic minority. These populations tend to see more physicians, have more office visits and take more medications. Too often, there is no one to coordinate this care. This failure to coordinate leads to poor care, such as: †¢ Duplicative tests or procedures †¢ Medication errors †¢ Avoidable hospital admissions †¢ Preventable hospital readmissions †¢ Unnecessary nursing home placements This fragmentation comes at a cost. Overall, health care costs represent 16 percent of our Gross Domestic Product. In 2009, we spent $2.9 trillion on health care. The cost of health care services provided to vulnerable populations is disproportionate to their numbers. For instance, 96 percent of Medicare dollars and 80 percent of Medicaid dollars are spent on patients with multiple chronic conditions. And, Medicaid and Medicare spend four times as much for the nearly nine million dually eligible beneficiaries than for non-duals. This disproportionate spending is in part because these populations have more complex health care needs. But preventable hospitalizations, complications and unnecessary nursing home admissions contribute significantly to these high costs. Improving the health delivery system for these vulnerable people will improve the quality of their lives, while also saving money. Page 2 National Health Reform and Delivery System Change, June 2010 Community Catalyst is a national non-profit advocacy organization building consumer and community leadership to transform the American health care system. www.communitycatalyst.org 2 New opportunities emerging from national health care reform Noted Harvard surgeon and author Atul Gawande said it best in his December 2009 New Yorker article â€Å"Testing, Testing,† where he responded to claims that there was no master plan for improving quality and reducing costs in the then-pending national reform bills. Drawing from what’s worked in agriculture, he said that â€Å"[t]o figure out how to transform medical communities, with all their diversity and complexity, is going to involve trial and error. And this will require pilot programs – a lot of them.† Indeed, the PPACA is filled with just these types of reforms aimed at testing what works. By its very nature, it acknowledges the differences among health delivery systems. While there are too many reforms to cover, this brief aims to discuss some those that hold the most promising for states to improve the health of vulnerable populations. In exchange, designated providers receiving payment for these services must provide regular reports to the state on a set of applicable quality measures. The New Jersey Legislature is currently considering a bill that would create a primary care medical home demonstration project. Should that bill pass, New Jersey could explore taking this state option, and advocates could weigh in on the development of quality measures that are most relevant to vulnerable populations. Accountable care organizations (ACOs) The new law creates a general ACO pilot program in Medicare4 and a pediatric ACO demonstration project in Medicaid,5 in which groups of providers who work together to improve the quality of care they deliver to beneficiaries will be permitted to keep half the savings they achieve over a three-year period. Participating ACOs must promote evidence-based medicine and patient engagement, report on quality and cost measures and coordinate care. They must also demonstrate that they meet patient-centeredness criteria, such as the use of patient and caregiver assessments or the use of individualized health plans. The criteria by which a group of providers will be judged in order to qualify as an ACO will be determined by regulation issued by the Department of Health and Human Services, which will also determine the measures to be used to assess the quality of care provided by the ACO. There is already interest in New Jersey in creating an ACO demonstration project to serve urban, underserved communities. Creating a state project may position New Jersey to take advantage of the federal pilot funding. Home and community-based services (HCBS) The new law offers incentives to states that provide HCBS to individuals instead of placing them in nursing homes.6 Specifically, the law increases Federal Medical Assistance Percentage (FMAP) payments to States that decrease the percentage of spending while increasing spending on HCBS.

Conclusion

My name is Frederica Krebs. I am a 29-year-old free-lance journalist. I write about all things happening in Germany, and then sell them to newspapers and magazines all over the world. I am the only son of a World War 1 hero, and my mother who dollies me. I am divorced with one son who resides with his mother. I'm young, blonde, blue-eyed, strong, and pure German. I'm what you would consider Hitler ideal German to be. Rather than believing In the Whimper republic, I believe In democracy.I consider he Whimper republic to be week and helpless. I do not Like what these groups of thugs who call themselves â€Å"Nazis† are trying to do. I mean they are trying to blame the war on the Jews, communists, and the liberals. Saying how Hitler will bring the Germans back to their farmer greatness. My own father agrees with the Nazis, he is already eager to rid the country of foreigners and especially Jews. But he doesn't know that I have a Jewish girlfriend, named Anna. Also my wife is rais ing our son to become one of these criminals.He is only five and already belongs to some Nazi out organization. I will do whatever it takes to make sure that these people don't do anymore damage to our country. Second Entry February 27,1933 what they believe in but what he believes in. I on the other hand will not give in and choose not to take the oath and make a stand for what I believe in. I will try and contribute to working to defeat Hitler as much as I can. Since I am a Journalist I can write about all the bad things happening to our country.After writing about these events I will sell them to newspapers and magazines all over the world, so they would now how much of a threat Hitler is not only to the people of Germany but also to the world. Third Entry May 10,1933 Today is the day of the book burning kids running around yelling like the burning of the books doesn't even bother them, they don't know how much books would help them because their young children doing what they th ought was right. The Nazis and police are knocking on people's doors and confiscating their books, I know a lot of people who don't agree with this but don't want to put the lives of their family in danger.Me being a Journalist I do not agree with this one bit not having books would hang how we think so we wont have our own opinions, we would all have the same thoughts because we are only allowed to read similar books. I will have to go to this book burning later this evening and I will have a decision to make whether I want to participate in this and throw a book into the fire or try and stop them from throwing the books, so as I have returned you know I have made the decision to Join in on the burning.A little boy came up to me and tried to put a book in my hand, as I refused a soldier walks up and stands right behind the boy staring at me and says, if you have rust in what Hitler is doing you will take the book and throw it in. I did not want to get arrested and loose the chance of spreading the word to the world about what's happening here so I took the book and tossed it. It was a very hard thing to do but I did it for the sake of my country. Fourth Entry August 1,1936 I am here in Berlin for the Olympic games to support my country of course. I walk into the stadium.There are so many people but not Just Germans other nationalities are here to cheer on their country. I feel as if everywhere like they were watching my every move. I also notice some American reporters were also there, maybe this is my chance to get out to the world about what was happening here. The people here would know nothing about what's going on here because Hitler had all the the people from other countries. I hope I could have a chance of speaking with one of the U. S reporter but its not going to be easy with all the AS officers around watching.If they see me attempting to talk to the reporters I will be arrested and punished maybe even killed. I have decided that trying to talk to the reporters would be too risky so I will not try and talk to them. Because if I get arrested I would leave my girlfriend who is Jewish alone and could possibly get taken away, and my father would find out that I was going against Hitler and he believes in what Hitler is doing. If I got caught it could also put my family in danger who knows what Hitler would do with them.Fifth Entry September 29,1936 Today I am having a private dinner with Josef Gobbles a friend and worker of Hitler. Gobbles is also a Journalist but he is one for the Nazi party and has been since 1926. I wanted this meeting because if I could get a Job as a Journalist for the Nazi party, after I earn their trust I could easily get the word out to the world and the would never suspect it was me. At the dinner we discussed my believes to be on that Hitler is doing and what they expect of me as a Journalist.When I looked at Gobbles I would have never thought he would be in the Nazi party because he was a total opposit e of the perfect German that Hitler described. He was small, dark and crippled with a permanent limp. After I saw him I knew I could get the Job because I was the perfect German that Hitler described, and why would they turn down a reflect German. I would also be able to keep my girlfriend unharmed if I Join the Nazi party. At the end of the dinner he said he would like to offer me a Job to work with him as a Journalist, so I shook his hand and gladly accepted.Sixth Entry November 10,1938 It's all starting today what the newspapers called Charlatanic: the night of broken glass. I look outside and see all Jewish businesses being burned down, or severely damaged. Not only are their businesses being destroyed they are being pulled out from their homes a lot of the times dragged out and beaten. The Nazi mobs were Sioux towards them worse than eve seen before sometimes beating the Jews in the city by the hundreds. I have a choice to make, do I try and save my girlfriend and risk being ca ught or do I Just give her up to them and never see her again.I can't do that to her I need to find a place for her to hide a place they would never think to look here. The mob is almost to my house I have to think quickly or I will loose her to those monsters. I told her to go outback and under the stairs outside there's an opening because he was the one that put in the newspaper to do this so all he would do is urn me in. As I started to calm door I hear a knock at my door but there was no shouting I open it and before my eyes was a family, a Jewish family that had escaped and asked for my help.I had to think but think quickly cause the mob was only down the street, so I told them to go where I had told my girlfriend to o and wait till I came and got them. The mob was finally at my door they asked if I had any Jews in here I said no. The people barged in and started to raid my home they finally left after ten minutes of searching and found nothing, my home a mess but they found no thing. Seventh Entry November 1 2, 1938 I have moved away from my old home to try and get away from all the madness.I still have work so ill Just do the work from here I live near Auschwitz Brinkmen. Life here is good for me but little did I know when I moved out here that I moved near a camp. In the beginning, I thought ghettos were for Just the poor, now I know that the Germans were forcing the Jews to live there and then moving them to concentration camps. I can go for a walk and see this camp and see the people in it but I can't do anything to help them. I see the labor they have to do, they look all sluggish and beat, you can see the guards yelling and beating them when they stop working.I see groups of young kids, elders, and weak go into these buildings while being escorted by troops so they couldn't run, the guards close the door and the group would never come out. I knew what had happened to them but I never knew how it was happening. I know these types of things IM Just a writer. It is hard to watch this all happening wishing I could do something but risk being killed myself and loosing the trust of Gobbles. Eighth Entry November 4,1943 I have witnessed the massacre, now I have lost the little respect I had for the German soldiers, Hitler, and Hammier.Hammier doesn't care how many Jews die because of his success. Being a Journalist I had to be to there witnessing a side I had never seen before of these soldiers and leaders. I saw dead bodies on the ground lined up in rows like they were in an assembly line. But the worst was I actually seeing the killings, they had them line up and like a firing squad they shot them in the neck. Some of the people were even still alive after they were shot and they Just feet them there.But even if you turn around to try and look away there were more trucks full of more Jews waiting to be slaughtered. The sad thing was it wasn't Just clothes so they were killed naked. More and more trucks come and go, unloading then k illing the defenseless they were weak and hungry. This is one of the worst things I had ever seen. Ninth Entry October 8,1944 â€Å"First they took the land Then they took the people Then they took me and there was no one left The demons in disguise Creating chaos in every direction What we sure can do Never let this pain happen again. Conclusion My name is Frederica Krebs. I am a 29-year-old free-lance journalist. I write about all things happening in Germany, and then sell them to newspapers and magazines all over the world. I am the only son of a World War 1 hero, and my mother who dollies me. I am divorced with one son who resides with his mother. I'm young, blonde, blue-eyed, strong, and pure German. I'm what you would consider Hitler ideal German to be. Rather than believing In the Whimper republic, I believe In democracy.I consider he Whimper republic to be week and helpless. I do not Like what these groups of thugs who call themselves â€Å"Nazis† are trying to do. I mean they are trying to blame the war on the Jews, communists, and the liberals. Saying how Hitler will bring the Germans back to their farmer greatness. My own father agrees with the Nazis, he is already eager to rid the country of foreigners and especially Jews. But he doesn't know that I have a Jewish girlfriend, named Anna. Also my wife is rais ing our son to become one of these criminals.He is only five and already belongs to some Nazi out organization. I will do whatever it takes to make sure that these people don't do anymore damage to our country. Second Entry February 27,1933 what they believe in but what he believes in. I on the other hand will not give in and choose not to take the oath and make a stand for what I believe in. I will try and contribute to working to defeat Hitler as much as I can. Since I am a Journalist I can write about all the bad things happening to our country.After writing about these events I will sell them to newspapers and magazines all over the world, so they would now how much of a threat Hitler is not only to the people of Germany but also to the world. Third Entry May 10,1933 Today is the day of the book burning kids running around yelling like the burning of the books doesn't even bother them, they don't know how much books would help them because their young children doing what they th ought was right. The Nazis and police are knocking on people's doors and confiscating their books, I know a lot of people who don't agree with this but don't want to put the lives of their family in danger.Me being a Journalist I do not agree with this one bit not having books would hang how we think so we wont have our own opinions, we would all have the same thoughts because we are only allowed to read similar books. I will have to go to this book burning later this evening and I will have a decision to make whether I want to participate in this and throw a book into the fire or try and stop them from throwing the books, so as I have returned you know I have made the decision to Join in on the burning.A little boy came up to me and tried to put a book in my hand, as I refused a soldier walks up and stands right behind the boy staring at me and says, if you have rust in what Hitler is doing you will take the book and throw it in. I did not want to get arrested and loose the chance of spreading the word to the world about what's happening here so I took the book and tossed it. It was a very hard thing to do but I did it for the sake of my country. Fourth Entry August 1,1936 I am here in Berlin for the Olympic games to support my country of course. I walk into the stadium.There are so many people but not Just Germans other nationalities are here to cheer on their country. I feel as if everywhere like they were watching my every move. I also notice some American reporters were also there, maybe this is my chance to get out to the world about what was happening here. The people here would know nothing about what's going on here because Hitler had all the the people from other countries. I hope I could have a chance of speaking with one of the U. S reporter but its not going to be easy with all the AS officers around watching.If they see me attempting to talk to the reporters I will be arrested and punished maybe even killed. I have decided that trying to talk to the reporters would be too risky so I will not try and talk to them. Because if I get arrested I would leave my girlfriend who is Jewish alone and could possibly get taken away, and my father would find out that I was going against Hitler and he believes in what Hitler is doing. If I got caught it could also put my family in danger who knows what Hitler would do with them.Fifth Entry September 29,1936 Today I am having a private dinner with Josef Gobbles a friend and worker of Hitler. Gobbles is also a Journalist but he is one for the Nazi party and has been since 1926. I wanted this meeting because if I could get a Job as a Journalist for the Nazi party, after I earn their trust I could easily get the word out to the world and the would never suspect it was me. At the dinner we discussed my believes to be on that Hitler is doing and what they expect of me as a Journalist.When I looked at Gobbles I would have never thought he would be in the Nazi party because he was a total opposit e of the perfect German that Hitler described. He was small, dark and crippled with a permanent limp. After I saw him I knew I could get the Job because I was the perfect German that Hitler described, and why would they turn down a reflect German. I would also be able to keep my girlfriend unharmed if I Join the Nazi party. At the end of the dinner he said he would like to offer me a Job to work with him as a Journalist, so I shook his hand and gladly accepted.Sixth Entry November 10,1938 It's all starting today what the newspapers called Charlatanic: the night of broken glass. I look outside and see all Jewish businesses being burned down, or severely damaged. Not only are their businesses being destroyed they are being pulled out from their homes a lot of the times dragged out and beaten. The Nazi mobs were Sioux towards them worse than eve seen before sometimes beating the Jews in the city by the hundreds. I have a choice to make, do I try and save my girlfriend and risk being ca ught or do I Just give her up to them and never see her again.I can't do that to her I need to find a place for her to hide a place they would never think to look here. The mob is almost to my house I have to think quickly or I will loose her to those monsters. I told her to go outback and under the stairs outside there's an opening because he was the one that put in the newspaper to do this so all he would do is urn me in. As I started to calm door I hear a knock at my door but there was no shouting I open it and before my eyes was a family, a Jewish family that had escaped and asked for my help.I had to think but think quickly cause the mob was only down the street, so I told them to go where I had told my girlfriend to o and wait till I came and got them. The mob was finally at my door they asked if I had any Jews in here I said no. The people barged in and started to raid my home they finally left after ten minutes of searching and found nothing, my home a mess but they found no thing. Seventh Entry November 1 2, 1938 I have moved away from my old home to try and get away from all the madness.I still have work so ill Just do the work from here I live near Auschwitz Brinkmen. Life here is good for me but little did I know when I moved out here that I moved near a camp. In the beginning, I thought ghettos were for Just the poor, now I know that the Germans were forcing the Jews to live there and then moving them to concentration camps. I can go for a walk and see this camp and see the people in it but I can't do anything to help them. I see the labor they have to do, they look all sluggish and beat, you can see the guards yelling and beating them when they stop working.I see groups of young kids, elders, and weak go into these buildings while being escorted by troops so they couldn't run, the guards close the door and the group would never come out. I knew what had happened to them but I never knew how it was happening. I know these types of things IM Just a writer. It is hard to watch this all happening wishing I could do something but risk being killed myself and loosing the trust of Gobbles. Eighth Entry November 4,1943 I have witnessed the massacre, now I have lost the little respect I had for the German soldiers, Hitler, and Hammier.Hammier doesn't care how many Jews die because of his success. Being a Journalist I had to be to there witnessing a side I had never seen before of these soldiers and leaders. I saw dead bodies on the ground lined up in rows like they were in an assembly line. But the worst was I actually seeing the killings, they had them line up and like a firing squad they shot them in the neck. Some of the people were even still alive after they were shot and they Just feet them there.But even if you turn around to try and look away there were more trucks full of more Jews waiting to be slaughtered. The sad thing was it wasn't Just clothes so they were killed naked. More and more trucks come and go, unloading then k illing the defenseless they were weak and hungry. This is one of the worst things I had ever seen. Ninth Entry October 8,1944 â€Å"First they took the land Then they took the people Then they took me and there was no one left The demons in disguise Creating chaos in every direction What we sure can do Never let this pain happen again.

Hybrid System for Automobiles

As you will well appreciate, the issue of hybrid automobile systems has gained increased prominence in the recent past. This is as a result of the drawbacks associated with the conventional automobile systems currently in use and the potential benefits that hybrid systems can offer.At present, our company, like many automobile manufacturers, produces vehicles that run on the conventional internal combustion engine. Since this involves the combustion of fossil-based fuels such as gasoline and diesel, it is associated with the emission of noxious gases such as carbon dioxide, carbon monoxide, nitrogen oxides and waste hydrocarbons that significantly compound the problem of global warming in addition to increasing the risk of heart, lung, respiratory and eye illnesses.Fossil fuels are also manufactured from oil, which has recently been the subject of steep price hikes that affected many motorists.Hybrid systems are not only cleaner but also incur cheaper operational costs. They would gi ve our company an opportunity to demonstrate its social responsibility and commitment to the environment and generate positive PR spin offs for it. It would also help the firm generate more sales revenues and to maximize its profits.Towards this end, I have prepared a proposal that seeks to design, develop, and implement an automobile hybrid system to be incorporated into our vehicles. Given the time schedule, reliability, schedule visibility, clarity of technology and user requirements associated with the development of the proposed system, we propose to use a throwaway prototyping model, a type of the Systems Development Life Cycle (SDLC).The entire project is expected to take one year, and will involve experts drawn from the different functional areas of the organization as well as outside consultants. Other resource requirements will include finances to purchase raw materials and modify existing production facilities.Given the unmistakable benefits that the hybrid automobile sys tem offers, there is no doubt that the benefits that our company will reap from its implementation will outweigh the costs by far. I will be glad to clarify or discuss with you any issues appertaining. Thank you.

Introduction to Modern Management

Introduction to Modern Management Lindsay Bursar Aspen University Abstract Throughout history many different theories have been developed, researched, written about and put to the test in actual work place setting to see how well they work and how effective they are. Lower-level management, comprehensive analysis of management and human relations movement in management theory are Just a few of them. Each theory was and still is important in today's modern business world.Every theory has had some kind of impact on the new theories in management that eave come about since then and will still continue to have an impact in the future. It's important that managers now and managers in the future are educated on these different management theories so that they can provide the support and education to their employees need and deserve. This will foster a positive work environment that will lead to increased productivity and success within companies. Every company must have good, competent man agers in order to survive and be successful.Module 1 Introduction to Modern Management Assignments: Essay Questions â€Å"Managers should be paid more than regular employees. † Do you agree with this statement? Justify your answer in scholarly detail. There are many reasons management should be paid more than a regular employee. One of the reasons being the workload managers take on and another being the necessary skills that a manager must possess to name Just a few. As a current member of management at the hospice agency I work for, I agree that management should be paid more.However, I agreed with this before I became management as well. As a regular employee I saw everyday how different the workload was between a regular employee and management. According to a recent study an average manager is actually worth 1. 75 employees (Edwards, 2012). After being promoted into my current management position, I agree with this statement 100%. Now instead of doing the Job of one, I'm doing the Job of three and still manage to get everything done and in on time or ahead of a deadline while also managing my employees.Employees in my old position who have the workload of only one sometimes struggle to meet the same deadlines. The expectation of productivity is much higher for a manager versus those of a regular employee. The importance of a good manager cannot be stressed enough. Management influences every aspect of an organization from top management to lower level management (Cert. & Cert., 012). If any organization or company intends on being successful then it is of the utmost importance that they hire good management because these people are the ones who lead the company towards their goals and towards success.Good management must have the skills to carry out the four basic management functions; planning, organizing, influencing and controlling (Cert. & Cert., 2012). Without these skills any member of management would be ineffective and unsuccessful. Manager s should be paid more than regular employees because not every employee in an organization possesses these skills. If every employee did, the need for management would be obsolete. â€Å"Discuss in scholarly detail why it is important for managers to be aware of cultural differences in their dealings with people. One of the biggest reasons it's important for management to aware of cultural difference is because of the increase in multi-national businesses and business deals. In today's business world an increasing number of companies have started doing business with people from different countries and cultures. Because of this trend of globalization, it is very important that managers understand and respect cultural differences. If differences in customs and culture are not known or not respected, business deals can quickly go south and be lost (Brown).Managers must know what kind of behaviors would be inappropriate in situations where you are dealing with people from other culture s in order to avoid doing anything that would be deemed rude or disrespectful. They need to be able to teach their employees what is acceptable and prepare their employees and themselves for interactions where this knowledge is paramount. One of the best things managers can to do to prepare their staff for these interactions is cultural awareness training (Acculturates! Consulting, 2011).By giving staff cultural awareness training they're being given the tools to learn about the customs and cultures they'll be interacting with. Employees will go to meetings for business deals or potential business deals armed with the cultural knowledge to ensure that they will not offend or come across as disrespectful. This training and knowledge that managers give to their employees will enable them to be culturally sensitive. This will make not only the employees, but also the company move forward and be successful in the international business world. How is lower-level management analysis diffe rent from comprehensive analysis of management? Is the latter approach suitable for an organization focusing on increasing productivity by concentrating on the ‘one best way to perform a task? Explain your answer in scholarly detail! † According to Cert. & Cert. (2012), â€Å"lower-level management analysis concentrates on the ‘one best way to perform a task† (p. 28). This means each task a worker does is closely looked at and studied to come up with the most efficient way to complete the task that will yield the highest production.This approach is also known as the scientific method of management (Cert. & Cert., 2012). Frederick W. Taylor has come commonly known as the creator of scientific management. While Taylor worked at Bethlehem Steel Co. His goal was to increase worker efficiency and productivity. He did this on the idea that â€Å"every Job had one best way to do it and that this way should be discovered and put into operation† (Cert. & Cert. , 2012, p. 29). This approach differs from the comprehensive analysis of management because it looks at very specific tasks and simplifies each task as much as possible to create efficiency.Comprehensive analysis of management focuses on â€Å"the entire range of managerial performance† (Cert. & Cert., 2012, p. 32). Whereas lower-level management analysis or scientific management focused more on the micro aspects of how to efficiently do a Job, comprehensive analysis of managements focuses on the macro aspects. Henry Payola was very influential in creating a management philosophy for the comprehensive analysis of management (Cert. & Cert., 2012). So much so that the general ideas and principles of management that he wrote about are still considered very useful in today's management world.Payola had 14 main principles of management that cover many different topics and believed that having managerial excellence is an ability that can be obtained (Summon, 2010). The three bigges t principles that Payola focused on were â€Å"organizational efficiency, the handling of people, and appropriate management action† (Cert. & Cert., 2012, p. 33). These principles can be seen being used in modern management today. I believe that using the comprehensive analysis of management is suitable to use in an organization that is focusing on the â€Å"one best way' to do a Job to increase the organizations productivity.While Frederick W. Tailor's contributions to the management world were very influential and important, they are also unpopular because of the extreme his ideas went to. In order to increase productivity the whole many should first be working towards a common goal or direction. If a company is focusing solely on the â€Å"one best way' to complete a task, that is the goal there are focusing on first with increased productivity second. By focusing on the â€Å"one best way,† other aspects and employees in a company are being ignored which ultimate ly will not lead a company towards increased productivity.Looking at a company and the company's goal in a comprehensive view is what will help achieve the goal of increased productivity. Everything and everybody must work in conjunction with one other to reach their goals. Discuss in scholarly detail the human relations movement in management theory. How would you, as a manager in an organization, use the human relations approach to manage employees? † According to Cert. & Cert. (2012), the human relations movement is â€Å"a people- oriented approach to management in which the interaction of people in organizations is studied to Judge its impact on organizational success† (p. 5). This movement was started because of the Hawthorne studies that were conducted from 1927 to 1932 by Professor Elton Mayo (Cert. & Cert., 2012). These studies gave managers a lot to think about and a new direction to start researching. The human relations movement focuses more on employees as individuals instead of focusing on procedures and policies in the workplace (Ziegler, 2014). Instead of a company environment that focuses on quotas and procedures, the environment focuses on communication between managers and employees.With a better understanding of employees and an environment more focused on communication, production and success for a company can actually increase. If the workplace is negative, noncommittal and unproductive, then there are some big changes that would need to be made. As a manager I would use this knowledge o learn about my employees and find out what motivates them to work more efficiently and productively. I would figure what exactly would help create commitment to the company from employees and grow off of that.I would start building relationships between management and employees to strengthen the unity within the company to continue working towards the common goal of success. If an attitude of commitment and high productivity can be grown and fostered within the employees then the manager is doing a good Job of creating an effective work environment. Good relationships with the employee's means employees are titivated and will work harder and more productively. â€Å"Discuss in scholarly detail how a manager's understanding of his employees' physiological, safety, social, esteem, and self-actualization needs improve productivity? Managers must have human relations skills in order to be effective. Human relations skills are defined as â€Å"the ability to work with people in a way that enhances organizational success† according to Cert. & Cert. (2012). It's important that managers understand Mascots Hierarchy of Needs to improve productivity within their employees. The five levels of Mascots Hierarchy of Needs are physiological, feet, social, esteem and self-actualization (Burton, 2012). In order for people to achieve the top level of self-actualization, each of the other levels must first be fulfilled starting wi th the lowest and then making the way up the hierarchy.These five levels are not only pertinent to people's lives outside of work but also their lives and well-being in the work place. The first level, physiological, is people's need for air, food, sleep, etc. If an employee doesn't have those basic needs met then they come to work tired or feeling sick and their productivity will be decreased. The second level, feet, has to do with people's need to feel secure. Within the workplace, employees need to feel safe and secure in their Job on a daily basis to keep up their productivity. The third level, social, refers to peoples need to feel a sense of belonging and acceptance.Within a company it's important that employees feel valued and part of a team. The fourth level, esteem, is what will make employees feel confident. After an employee masters a skill and is recognized for it, their self-esteem will rise. This can lead to an increase in productivity because they are proud of themsel ves and what they've accomplished. The last level is self-actualization. An employee strives to the best that they can and be all that they can possibly be. Once that is reached, the employee will be satisfied within their Job. They'll feel accomplished and part of a team.